Premium Essay

Econ 301 Problem Set 1

In: Other Topics

Submitted By reidm12
Words 392
Pages 2
Econ 301B

Winter 2012

Problem Set 1
Due date: Monday, January 23 in class
1. Suppose the country of Utopia has a population of 1,000 and produces only three goods:
T-shirts, cars and pineapples. Assume that Utopia does not trade with other countries. The production amounts and prices (in US Dollars) for 2009, 2010 and 2011 are given in the table below:

Year
2009
2010
2011

Quantity of Tshirts
10,000
9,500
10,500

Price of Tshirts

Quantity of cars Price of cars

Quantity of pineapples Price of pineapples $10
$10.50
$11

75
85
90

$15,000
$16,000
$15,500

50,000
60,000
45,000

$4
$4.50
$5

a) Using 2009 as base year, calculate nominal and real GDP per capita for 2009,
2010 and 2011.
b) Keeping 2009 as base year for prices, compute Utopia’s inflation rates for 2010 and 2011 using both the CPI and the GDP deflator. When calculating the CPI, assume that the representative consumer purchases in any given year 10 T -shirts, 1 car and 100 pineapples.
c) Explain why the computed inflation rates are not the same when u sing the two different methods.
2. For this question assume that we are within the short -run goods market framework developed in Chapter 3 in Blanchard. Suppose that the economy is characterized by the following behavioral equations:

Note that in this economy investment, I, depends positively on output, Y. This mirrors the fact that firms in the real world will increase their investment expenditure on capital goods when sales are picking up.
a) Write down and graph the supply and demand functions for the economy’s goods market. When drawing the goods market diagram, make sure to accurately label the intercepts and slopes of both fu nctions.

Econ 301B

Winter 2012

b) Solve for the following variables: equilibrium GDP (Y), disposable inco me (YD), consumption spending (C)…...

Similar Documents

Premium Essay

Econ 2101 Problem Set 6

...Econ 2101 - Hovander Problem Set 6 - Solutions 1) Define the hypothesis of (eventually) diminishing marginal product both mathematically and verbally. Does this hypothesis hold in the short run or the long run? Explain. The long run is defined as a period of time sufficiently long so that all inputs to production can be freely varied. In contrast, the short run is a period of time sufficiently short so that at least one input is fixed (cannot be varied). For simplicity, let’s make the standard assumption that the variable input in the short run is labor and proceed by defining the hypothesis in terms of labor. The hypothesis of eventually diminishing marginal product states that as we increase labor while holding all other inputs fixed, we will eventually reach a point where the additional output gained with each increase in labor gets smaller and smaller. (e.g. the 5th baker increases output by 3 loaves, the 6th baker by 2 loaves, the 7th baker by 1.) Since the hypothesis is regarding what we expect to see when we vary one input while holding others fixed, this hypothesis is relevant in the short run and not in the long run. Mathematically, the marginal product of labor is MPL = q( L, K ) . L Under the hypothesis of eventually diminishing marginal product (of labor), the following will eventually hold:  2 q( L, K ) 0. L2 (Again, note that this is a partial derivative, so we are hypothesizing this will be true when capital is held fixed, a short-run......

Words: 1745 - Pages: 7

Premium Essay

Mba510 Problem Set 1

...Week 3 Problem Set 1: Chapter 3: 62, 72 62) The Citizens Banking Company is studying the number of times the ATM located in a Lob laws Supermarket at the foot of Market Street is used per day. Following are the numbers of times the machine was used over each of the last 30 days. Determine the mean number of times the machine was used per day. 83 64 84 76 84 54 75 59 70 6163 80 84 73 68 52 65 90 52 7795 36 78 61 59 84 95 47 87 60 Answer: The ATM machine was used a mean number of times 70. 53. 72.) The weights (in pounds) of a sample of five boxes being sent by UPS are: 12, 6, 7, 3, and 10. 1. Compute the range. 3-12 2. Compute the mean deviation. 7.6 3. Compute the standard deviation. Chapter 5, 66 66) A survey of undergraduate students in the School of Business at Northern University Revealed the following regarding the gender and majors of the students: Major Gender Accounting Management Finance Total |Gender |Accounting |Major/management |Finance |Total | |Male |100 |150 |50 |300 | |Female |100 |50 |50 |200 | |Total |200 |200 |100 |500 ......

Words: 478 - Pages: 2

Premium Essay

Econ Problem Set Key

...1. The American Bagel Co. is considering opening a Bagel bakery and coffee shop near Campus. In an effort to predict the profitability of this venture, their in-house consulting team estimated that the daily demand for Bagels in the area to be the following Q = -5P + 20Pp - 30Pc +5I Where P = the price of bagels, Pp = the price of pastries (each), Pc = the price of coffee (per cup), and I = Income (average annual per capita, for local residents in thousands of dollars) a. Comment on this estimated demand function. Are the parameters reasonable? Why or why not? (Restrict your commentary to the signs of the parameters) Reasonable Sign? (Y/N) Reason P _______Y__________________________Downsloping Demand Curve (d.m.u.) Pp ______Y_________________________Pastries and Bagels are Substitutes Pc ______Y_________________________Coffee is a complement__________ I _______Y________________________Food consumed at a café s probably a normal good b. Suppose that the price of pastries = $1, coffee costs $.50 per cup, and average per capita income in the fan area is $12,000. Calculate the inverse demand curve (e.g., express price as a function of quantity). Demand: Q = -5P + 20(1)- 30(.5)+ 5(12) = -5P +65 Inverse demand _______P = 13 - Q/5______________________ c. What happens to the predicted number of bagels sold per day if the price of bagels is increased from $1.00 to $2.00? Is this a change in demand or a change in......

Words: 458 - Pages: 2

Premium Essay

Econ Problem Set 5

...Problem Set 5 Liberty University Feb 17 28, 2013 ECON 214 D14 Principles of Macroeconomics 1. What impact will an unanticipated increase in the money supply have on the real interest rate, real output, and employment in the short run? How will expansionary monetary policy affect these factors in the long run? Explain. When income rises, more people are placed in the region above the no tax due cutoff. Others find themselves pushed into a higher tax brackets. Therefore, the process of an economical expansion, revenue from the personal income tax increases more swift than income. Over a short run, this will lead to improved margins in profit for businesses who will lead to the expansion of the output through utilization of more resources. In the short run, unemployment rate will fall. 2. How rapidly has the money supply (M1) grown during the past twelve months? State the rate of growth (use http://www.federalreserve.gov/releases/h6/) and the most recent release, use the seasonally adjusted figures. Calculate the rate of growth across the year by taking the (new amount of M1- old amount of M1)/old amount of M1). Given the state of the economy, should monetary authorities increase or decrease the growth rate of money? Explain why. The Money supply has grown in a steady state. In the year 2013 the rate of growth is: (26-24)/24 = 0.08333. The monetary authorities should increase the growth rate of money. The growth rate in this case is very low and cannot......

Words: 667 - Pages: 3

Premium Essay

Econ 214 Problem Set

...Rachel Wilkinson ECON 214-B14 Prof. Kuo January 28, 2013 Problem Set 1 1) Real dollars for 2010 (largest to smallest real box office receipts, in millions) Star Wars ($1,661.9) E.T. ($903.8) Titanic ($816.4) Avatar ($773.3) Shrek 2 ($504.8) 2) employed, unemployed, or not in the labor force a. Beth is not working; she applies for a job at Wal-Mart last week and is awaiting the result of her application - unemployed b. Juan is vacation in Florida during a layoff at General Motors plant due to a model changeover, but he expects to be recalled in a couple of weeks - not in the labor force c. Bob was laid off as a carpenter when a construction project was completed. He is looking for work but has been unable to find anything except a $10 per hour job which he turned down - unemployed d. Jade works 70 hours per week as a homemaker for her family of 6 - unemployed e. Carson , a 17 year old, works six hours per week as a delivery person for the local newspaper - employed f. Brady works three hours in the mornings at the clinic and for the last two weeks has spent the afternoons looking for a full time job - employed 3) labor force participation rate/ unemployment rate/ employment/population ratio a. Labor Force Participation Rate - 48.7% b. Unemployment Rate - 8% c. Employment/Population Ratio - 40.7% 4) AD and SRAS a. 5400 b. Yes, it is a long run equilibrium level of GDP because the economic profits are zero. The...

Words: 347 - Pages: 2

Premium Essay

Problem Set 3 Econ 214

...Problem Set 3 1. Will increases in government spending financed by borrowing help promote a strong recovery from a severe recession. Why or why not? * Yes. The Keynesian view that private spending will decline during a recession and that the government needs to expand its spending in order to restart the private sector. 2. Does fiscal policy have a strong impact on aggregate demand? Did the shift of the federal budget from deficit to surplus during the 1990s weaken aggregate demand? Did the government spending increases and large budget deficits of 2008–2011 strengthen aggregate demand? Discuss. * Aggregate demand does not depend on fiscal policy. So, therefore it has no impact. * It does not indicate if it had a strong or negative impact or not. * the growth of real output and income during the next decade shold be strong, if the Keynesian are right. 3. What is the current rate of unemployment? (See bls.gov and state the month you are reporting.) How rapidly has GDP grown during the past 3 years? (See bea.gov and state the annual growth rate for each year.) What do these figures indicate about the validity of the Keynesian view? * 6.1% in Aug 2014 * 2011: 1.8 * 2012: 2.2 * 2013: 1.3 It indicates that the GDP has very litte impact than what they expected. 4. Are changes in discretionary and fiscal policy likely to be instituted in a manner that will reduce the ups and downs of the business cycle? Why or why not? ......

Words: 277 - Pages: 2

Free Essay

Problem Set 1

...Problem Set 1 MGT-309 – Intro to Logistics Management November 23, 2014 Cosme Lucio Professor Jerry Bilbrey 2a. 2*8*44,000=704,000 .12*.75=.09 704,000/.09= 7,822,222.222222222 = 2796.823595120404 = 2797 2b. Inventory Carrying Costs = (2,797/2)*0.75*12% = $125.87 Order Costs = (44,000/2797) = 15.73 = 16, 16*$8(per order) = $128.00 Transportation Costs = 44,000 units *0.05 per unit = 2,200 (Q=2,797) = 125.87+128+2,200= 2453.87 Inventory Carrying Costs = (4,000/2)*.075*12% = $180 Order Costs = 44,000/4,000 = 11orders, 11orders*$8 per order = $88 Transportation Costs = 44,000*$0.04 per unit = $1760.00 (Q=4,000) = 180+88+1,760 = 2,028 2c. 4,000 CUPS = 11 orders, 33 days between orders 4a. Common days’ supply of chocolate chewies at DC: DS= [(42,000 – 7,000) + 18,500]/4,500 = 11.8888889 = 12(Rounded Up) 4b. Fair Share Allocation Logic: Cincinnati Allocation = (11.8888889 * 2,500) – 12,500 = 17,222.2222 Phoenix Allocation = (11.8888889 * 2,000) – 6,000 = 17,777.7778 6a. Yes. The demand never exceeded what was in stock and causing a stockout. 6b. SD = 1.811 6c. Yes. The frequency wasn’t out of bounds with mean, mode, median. 6d. SD = 1.095445 6e. SD of Combined Probabilities = 6 6g. f(k) = 0.061667 6h. k = 1.1, Required safety stock for the desired 99 percent is 6.42 with an average inventory of 36 6i....

Words: 252 - Pages: 2

Premium Essay

Econ 213 Problem Set 4

...Problem Set 4 Name: ________Kristina Silva______________________________________ Problem Set 4 is to be completed by 11:59 p.m. (ET) on Friday of Module/Week 8. 1. Movies are distributed in a variety of forms, not just first run theatrical presentations. What other ways are movies distributed? What are the different price points? Using this information, draw a fully labeled graph of the market for movies in which the distributor of the film price discriminates. (NOTE: This should not be perfect price discrimination.) There are retailers whe sell DVD or videos and then there are live streaming ways to distribute movies such as Netflix. (Q1 is vidoes/DVD’s, Q2 is Netflix) 2. Assume the following game is played one time only. Based on the information in the payoff matrix, PNC Bank and Citizens Bank are considering an implicit collusive agreement on interest rates. Payoffs to the two firms are represented in terms of profits in thousands of dollars: | | |Citizens Bank | | | | |Collude: Raise Rates |Defect: Keep Rates where they | | | | |are | |PNC |Collude: Raise Rates...

Words: 456 - Pages: 2

Premium Essay

Econ 214 Problem Set 5

...increases over time. However it will not go back to its original level. It will be higher by the same percentage as the money supply has been increased by. Monetary policy has different effects in the short run and the long run. Expansionary monetary policies designed to reduce short-term interest rates and spur full employment and economic growth eventually lead to higher interest rates as they induce inflation. This means that monetary policy must be carefully applied. If the Fed introduces a monetary stimulus, they must also plan to remove the stimulus in order to prevent future inflation. The problem for policymakers is in timing the policy. Early removal of monetary stimulus might result in a protracted recession, but maintaining low interest rates for too long will almost certainly lead to higher inflation. Too much reliance on monetary policy to reduce inflation can also lead to problems. Over the business cycle, if government uses expansionary fiscal policy to offset recessions and then relies on the Fed to contain periods of inflation, interest rates will ratchet up and long-term economic growth will be stymied. At some point government must reign in its spending and/or raise taxes to keep long-term interest rates from rising too high. Some observers think that the Fed's goals of price stability and full employment are mutually exclusive and impossible to simultaneously achieve. Those within the Fed who have a similar view tend to be labelled as inflation hawks for......

Words: 908 - Pages: 4

Premium Essay

Econ 213 Problem Set 3

...Problem Set 3 Problem Set 3 is to be completed by 11:59 p.m. (ET) on Monday of Module/Week 6. 1. Data for the market for graham crackers is shown below. Calculate the elasticity of demand between the following prices. |Price of crackers |Quantity Demanded (per month) | |$3 |80 | |$2.5 |120 | |$2 |160 | |$1.5 |200 | |$1 |240 | $1.00 - $1.50: Elasticity of demand equals .45; favoring inelasticity $1.50 - $2.00: Elasticity of demand equals .78; favoring inelasticity $2.00 - $2.50: Elasticity of demand equals 1.29; favoring elasticity $2.50 - $3.00: Elasticity of demand equals 2.2; favoring elasticity If the price of graham crackers is $2.50 should firms raise or lower their prices if they want to increase revenue? Explain this in terms of elasticity. The firm should lower their prices 50 cents in an attempt to raise revenues. The elasticity of demand from 2.50-2.00 is 1.29, meaning with a reduction in prices there would be an elastic effect on quantity demanded. The maximum profit would be reached at the price of $2 because of the increased in demand with the price......

Words: 731 - Pages: 3

Premium Essay

Economics Problems Set 1

...MBA-FP6008: Assessment 1, Economics Problem Set 1 Dennis J. Johnson Capella University 08/12/2015 Problems A, B, and C Introduction This assessment will be an analysis of graphed data and changes in supply and demand for three economic problems. Problem A involves production possibilities for consumer and capital goods, problem B is an evaluation of changes in supply and demand equilibrium, and finally, problem C involves pricing with relevance to supply and demand. Successful completion of this assessment demonstrates proficiency in; applying theories, models, and practices of economic theory, analyzing solutions with support from relevant data, resources, references, and economic principles, analyzing graphed and circular flow diagram data, and analyzing changes in supply and demand in a competitive market. Problem A. Production Possibilities | Type of Production | Production Alternative A | Production Alternative B | Production Alternative C | Production Alternative D | Production Alternative E | Butter | 0 | 1 | 2 | 3 | 4 | Guns | 15 | 14 | 12 | 9 | 0 | Production Possibilities for Consumer Goods (Guns) and Capital Goods (Butter) 1. The specific assumptions that underlie the production possibilities curve are: that there are only two goods, consumer and capital, that they are produced in different proportions in the economy, the quantities of the resources do not change, production techniques are given and constant, and that resources......

Words: 1353 - Pages: 6

Premium Essay

Problem Set 1

...Problem Set #1 Date 09/22/2015 Sayantani Nandy 1. Sign into Bloomberg and check IBM's page (IBM US Equity). Check Company Overview and then Company Management. Find the composition of the Management Team and the Board and check the backgrounds of the Chair as well as the top 3 longest serving board members. (a) How many of these three board members appear to be independent? (b) What are their compensations? (c) What other board memberships or executive positions do they hold? (d) Do you think having these positions help increase or reduce agency cost and help better align the interest of shareholders with management? Answer: I will start to answer the question with a table of summary: IBM Corp Inc. Sr. No Tenure . (yrs.) 1 2 Independent Board Member CompenCurrent sation shareholding Kenneth Chenault 17.8 "Ken" Other Board/Executive Positions Company Name Title Yes / No Bloomberg Philanthropists Board Member Presidents & Fellows of Harvard Board Member College Proctor & Gamble Company Board Member No American Express Travel related Chairman services Co. American Express Co. Chairman $341,193 $ 1,031,972 BM Corp. Board Member Sidney 14.8 Taurel BioCrossroads IBM McGraw Hill Financial Mc Grawhill, Compensation and Leadership Development IBM, Executive compensation $368,724 $ 2,284,797 and management resources Name Board Member Board Member Board Member No Chairman Chairman Yes 3 Joan......

Words: 2087 - Pages: 9

Premium Essay

Problem Set 1

...Problem set 1 Exercise 1 Giving €10 to a friend does not affect GDP because it is just an exchange of paper and there is no new production. Because she loses the money, she cannot go to the movies, so she cannot consume anything. That transaction does not affect France's 2014 GDP. Expenditure: consumption in services increase by €50 (only the service fee and not the loan). Income side: wages and profits should increase by €50. Value added: services value added should increase by €50. Expenditure: consumption in goods increases, but imports also increases. GDP stays the same. Income side: it does not increase in France but in the US. Value added: it increases in the US and not in France Winning the lotery is just a money transfer, it does not involve production, therefore it does not affect GDP. It is legalized so it should count in GDP and increase it, but because it is domestic production, it is not meant to be sold, so it does not affect GDP. Expenditure: consumption in non-durable goods increases by €105. Income side: wages plus profits shoul increase by €105. Value added: Restaurants value added should increase by €105. Exercise 4 (i) NominalGDP2012 = QuantityTV * PriceTV2012 + QuantityComputers * PriceComputers2012 = 100*500+20*1,000 NominalGDP2012= €70,000 NominalGDP2013 = QuantityTV * PriceTV2013 + QuantityComputers * PriceComputers2013 = 80*400+30*1,200 NominalGDP2013= €68,000 NominalGDP2014 = QuantityTV *......

Words: 930 - Pages: 4

Premium Essay

Problem Set 1

...Problem Set 5: 1) Advantages include the fact that polyclonal is cheaper, a mixture of different antibodies are made while monoclonal is only one specific antibody (this might depend on the experiment as some might prefer different antibodies), and large quantities are made. Disadvantages are that the affinities of the antibodies differ, a good amount of a specific antibody can’t be made alone unlike monoclonal, it is less reliable, and the same sample can’t be guaranteed each time unlike the monoclonal which can bring similar clones months later. 3) The GFP-HDAC3 overlaps the DAPI where the nucleus is. This shows that HDAC3 is a nuclear protein. However, some deletions show that the nucleus has gone smaller while others show that the nucleus has gone larger. The goal of this experiment was to find out how the different portions of the protein affected localization in the cell. The experiment does show that there was a significant effect. 4) Sense: 5’ aagccccatcgcctggcattg 3’ Linker Loop: 5’ uucaagaga 3’ Antisense: 5’ caatgccaggcgatggggctt 3’ Poly U: UUUUU The goal of the knockout would be to see if the removed proteins had any effect on the function of the cell. The siRNA should be 30%-50% GC content, 21 bp in length, have a AA on the 5’ end, a linker, around 75 bp ds of the gene, and have a poly U tail. These conditions are satisfied but the GC content is slightly high. 5) Fold increase in HDAC3 mRNA gene in control vs experiment = 1488/151= 9.85 fold......

Words: 364 - Pages: 2

Premium Essay

Problem Set 1

...Problem Set 1 Problem 1 Which project should the firm select? Why? Project B: Managers should try to maximize their stock’s intrinsic value while also bringing in revenue. The P/E ratio shows the dollar amount investors will pay for $1 of current earnings. Problem 2 If most investors expect the same cash flows from Companies A and B but are more confident that A’s cash flows will be closer to their expected value, which company should have the higher stock price? Explain. The primary goal of a corporation should be to maximize its owner’s value. If a manager is to maximize shareholder wealth, he/she must know how that wealth is determined. Fundamentally, shareholder wealth is the number of shares outstanding at times the market price per share. A stock’s price at any given time depends on the cash flows a “marginal” investor expects to receive after buying the stock. With that being said, Company A’s cash flow would increase the stock price and the risk would be minimal. Management’s goal should be to make decisions designed to maximize the stock’s price. Problem 3 The president of Southern Semiconductor Corporation (SSC) made this statement in the company’s annual report: “SSC’s primary goal is to increase the value of our common stock holders’ equity.” Later in the report, the following announcements were made: a. The company contributed $1.5 million to the symphony orchestra in Birmingham, Alabama, its headquarters city b. The company is spending $500......

Words: 628 - Pages: 3

Ничего хорошего в отеле «Эль рояль» / Bad Times at the El Royale (2018) HDRip от Generalfilm | КПК | D | minitool power data | Unten am Fluss