Free Essay

Jnmd

In: Business and Management

Submitted By afcxlove
Words 5052
Pages 21
BLAST ®

Basic Local Alignment Search Tool
NCBI/ BLAST/ blastn suite/ Formatting Results - 2B3NWE4501R Formatting options Download Blast report description

APOE
RID 2B3NWE4501R (Expires on 09-28 00:05 am) Query ID Description Molecule type Query Length lcl|167571 None nucleic acid 1223 Database Name nr Description Nucleotide collection (nt) Program BLASTN 2.2.30+

Graphic Summary
Distribution of 128 Blast Hits on the Query Sequence

Descriptions
Sequences producing significant alignments:

Description
Homo sapiens apolipoprotein E (APOE), mRNA Homo sapiens apolipoprotein E, mRNA (cDNA clone MGC:1571 IMAGE:3355712), complete cds Homo sapiens cDNA clone IMAGE:6263100, **** WARNING: chimeric clone **** Homo sapiens preapolipoprotein E (APOE) mRNA, complete cds Human apolipoprotein E mRNA, complete cds PREDICTED: Pan paniscus apolipoprotein E (APOE), transcript variant X1, mRNA PREDICTED: Homo sapiens apolipoprotein E (APOE), transcript variant X1, mRNA PREDICTED: Pan paniscus apolipoprotein E (APOE), transcript variant X2, mRNA PREDICTED: Papio anubis apolipoprotein E (APOE), mRNA Macaca fascicularis mRNA, complete cds, clone Qlv-U403A-F8: similar to Homo sapiens apolipoprotein E (APOE), mRNA, NM_000041.2 PREDICTED: Macaca fascicularis apolipoprotein E (APOE), transcript variant X1, mRNA PREDICTED: Chlorocebus sabaeus apolipoprotein E (APOE), transcript variant X1, mRNA Homo sapiens cDNA, FLJ95802, Homo sapiens apolipoprotein E (APOE), mRNA Monkey mRNA for apolipoprotein E PREDICTED: Pongo abelii apolipoprotein E (APOE), partial mRNA PREDICTED: Macaca fascicularis apolipoprotein E (APOE), transcript variant X2, mRNA PREDICTED: Nomascus leucogenys apolipoprotein E (APOE), mRNA PREDICTED: Chlorocebus sabaeus apolipoprotein E (APOE), transcript variant X2, mRNA Pan troglodytes apolipoprotein E (APOE), mRNA

Max score
2206

Total score
2206

Query cover
100%

E value
0.0

Ident
100%

Accession
NM_000041.2

2138

2138

96%

0.0

100%

BC003557.1

2132

2132

96%

0.0

100%

BC072022.1

2082 2060

2082 2060

94% 94%

0.0 0.0

100% 99%

K00396.1 M12529.1

2046

2046

96%

0.0

99%

XM_003817545.2

2022

2022

91%

0.0

100%

XM_005258867.1

1939

2011

94%

0.0

98%

XM_008970765.1

1902

1902

96%

0.0

96%

XM_003918599.2

1884

1884

96%

0.0

95%

AK240626.1

1871

1871

96%

0.0

95%

XM_005589553.1

1864

1864

96%

0.0

95%

XM_007997155.1

1840 1817 1784

1840 1817 1784

83% 95% 86%

0.0 0.0 0.0

99% 94% 98%

AK314898.1 X13887.1 XM_002829380.3

1764

1764

91%

0.0

95%

XM_005589554.1

1759

1759

89%

0.0

95%

XM_004091027.1

1757

1757

91%

0.0

94%

XM_007997156.1

1757

1757

82%

0.0

99%

NM_001009007.1

Synthetic construct Homo sapiens clone ccsbBroadEn_14543 APOE gene, encodes complete protein Synthetic construct Homo sapiens clone IMAGE:100010219; FLH187373.01L; RZPDo839G0862D apolipoprotein E (APOE) gene, encodes complete protein Synthetic construct clone IMAGE:100005178; FLH187377.01X; RZPDo839G0872D apolipoprotein E (APOE) gene, encodes complete protein Synthetic construct DNA, clone: pF1KB8271, Homo sapiens APOE gene for apolipoprotein E, without stop codon, in Flexi system PREDICTED: Callithrix jacchus apolipoprotein E (APOE), mRNA Homo sapiens apolipoprotein E (APOE) gene, exon 4 and partial cds Homo sapiens apolipoprotein E (APOE) gene, complete cds Homo sapiens apolipoprotein E (APOE), RefSeqGene on chromosome 19 Homo sapiens chromosome 19 clone CTB-129P6, complete sequence Homo sapiens apolipoprotein-E gene, complete cds Homo sapiens clone F19374 APO E-C2 gene cluster, complete sequence Human apolipoprotein E (epsilon-4 allele) gene, complete cds Pan troglodytes apolipoprotein-E gene, complete cds Synthetic construct Homo sapiens gateway clone IMAGE:100023427 3' read APOE mRNA Baboon apolipoprotein E (ApoE) gene, complete cds PREDICTED: Macaca mulatta Apolipoprotein E (APOE), mRNA Cercopithecus aethiops apolipoprotein E precursor, gene, partial cds Gorilla gorilla apolipoprotein E (APOE) gene, exon 4 and complete cds Pongo pygmaeus apolipoprotein E (APOE) gene, exon 4 and complete cds Pan troglodytes apolipoprotein E (APOE) gene, exon 4 and complete cds Pan troglodytes apolipoprotein E (APOE) gene, exons 3, 4 and partial cds Hylobates lar apolipoprotein E (APOE) gene, exon 4 and complete cds PREDICTED: Otolemur garnettii apolipoprotein E (APOE), mRNA PREDICTED: Tupaia chinensis apolipoprotein E (APOE), transcript

1719

1719

77%

0.0

100%

KJ905144.1

1718

1718

77%

0.0

100%

DQ895759.2

1718

1718

77%

0.0

100%

DQ892548.2

1716

1716

77%

0.0

100%

AB463414.1

1692 1557 1557 1557 1557 1557 1557 1552 1501

1692 1557 2149 2149 2149 2149 2149 2143 2064

96% 70% 96% 96% 96% 96% 96% 96% 96%

0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

92% 100% 100% 100% 100% 100% 100% 99% 99%

XM_002762227.2 JX467472.1 FJ525876.1 NG_007084.2 AC011481.4 AF261279.1 AF050154.1 M10065.1 AF261280.1

1442

1442

75%

0.0

95%

CU678501.1

1393 1361 1342 1260

1920 1361 1342 1260

96% 69% 70% 58%

0.0 0.0 0.0 0.0

96% 95% 94% 99%

M29322.1 XM_001104482.2 AY738150.1 AF200502.1

1260

1260

58%

0.0

99%

AF200505.1

1254 1247 1236 1189

1254 1576 1236 1189

58% 74% 58% 88%

0.0 0.0 0.0 0.0

99% 99% 98% 85%

AF200499.1 JX826621.1 AF200508.1 XM_003799497.1

1124

1124

85%

0.0

84%

XM_006142065.1

variant X2, mRNA PREDICTED: Physeter catodon apolipoprotein E (APOE), mRNA Tupaia glis apolipoprotein E mRNA, complete cds PREDICTED: Balaenoptera acutorostrata scammoni apolipoprotein E (APOE), mRNA Bos taurus apolipoprotein E, mRNA (cDNA clone MGC:127905 IMAGE:7962554), complete cds PREDICTED: Tupaia chinensis apolipoprotein E (APOE), transcript variant X1, mRNA PREDICTED: Lipotes vexillifer apolipoprotein E (APOE), mRNA Bos taurus apolipoprotein E, mRNA (cDNA clone MGC:157255 IMAGE:8199348), complete cds PREDICTED: Canis lupus familiaris apolipoprotein E (APOE), transcript variant X5, mRNA Sus scrofa mRNA, clone: HTMT10033B05, expressed in hypothalamus PREDICTED: Tursiops truncatus apolipoprotein E (APOE), mRNA Oryctolagus cuniculus apolipoprotein E (APOE), mRNA Synthetic construct Homo sapiens gateway clone IMAGE:100023427 5' read APOE mRNA PREDICTED: Orcinus orca apolipoprotein E (APOE), mRNA Bos taurus cDNA clone IMAGE:8031513 PREDICTED: Canis lupus familiaris apolipoprotein E (APOE), transcript variant X1, mRNA PREDICTED: Odobenus rosmarus divergens apolipoprotein E, transcript variant 1 (APOE), mRNA PREDICTED: Bos taurus apolipoprotein E (APOE), transcript variant X3, mRNA PREDICTED: Bos taurus apolipoprotein E (APOE), transcript variant X2, mRNA PREDICTED: Bos taurus apolipoprotein E (APOE), transcript variant X1, mRNA B.taurus mRNA for apolipoprotein E PREDICTED: Bos mutus apolipoprotein E (APOE), mRNA Bos taurus apolipoprotein E (APOE), mRNA Bos taurus apolipoprotein E (APOE), mRNA, complete cds 1119 1103 1119 1103 94% 84% 0.0 0.0 82% 84% XM_007101265.1 AF303830.1

1094

1094

96%

0.0

81%

XM_007168118.1

1090

1090

94%

0.0

81%

BC102620.1

1085

1085

80%

0.0

84%

XM_006142064.1

1079

1079

91%

0.0

82%

XM_007458551.1

1076

1076

94%

0.0

81%

BC134729.1

1054

1054

96%

0.0

80%

XM_005616460.1

1050

1050

94%

0.0

80%

AK399873.1

1047 1045

1047 1045

91% 83%

0.0 0.0

81% 83%

XM_004331415.1 NM_001082643.1

1043

1043

56%

0.0

94%

CU678500.1

1041 1040

1041 1040

91% 92%

0.0 0.0

81% 81%

XM_004271187.1 BC149667.1

1018

1018

96%

0.0

79%

XM_533644.4

1016

1016

96%

0.0

78%

XM_004401003.1

1012

1012

91%

0.0

81%

XM_005219150.1

1012

1012

91%

0.0

81%

XM_005219149.1

1012 1012 1007 1003 1003

1012 1012 1007 1003 1003

91% 90% 91% 91% 91%

0.0 0.0 0.0 0.0 0.0

81% 81% 80% 80% 80%

XM_005219148.1 X61171.1 XM_005900307.1 NM_173991.2 BT021053.1

PREDICTED: Pantholops hodgsonii apolipoprotein E (APOE), transcript variant X1, mRNA PREDICTED: Canis lupus familiaris apolipoprotein E (APOE), transcript variant X4, mRNA PREDICTED: Mustela putorius furo apolipoprotein E (APOE), mRNA PREDICTED: Bubalus bubalis apolipoprotein E (APOE), transcript variant X2, mRNA PREDICTED: Bubalus bubalis apolipoprotein E (APOE), transcript variant X1, mRNA PREDICTED: Pantholops hodgsonii apolipoprotein E (APOE), transcript variant X7, mRNA PREDICTED: Pantholops hodgsonii apolipoprotein E (APOE), transcript variant X6, mRNA PREDICTED: Pantholops hodgsonii apolipoprotein E (APOE), transcript variant X5, mRNA PREDICTED: Pantholops hodgsonii apolipoprotein E (APOE), transcript variant X4, mRNA PREDICTED: Pantholops hodgsonii apolipoprotein E (APOE), transcript variant X3, mRNA PREDICTED: Pantholops hodgsonii apolipoprotein E (APOE), transcript variant X2, mRNA PREDICTED: Odobenus rosmarus divergens apolipoprotein E, transcript variant 2 (APOE), mRNA PREDICTED: Capra hircus apolipoprotein E (APOE), mRNA Sus scrofa mRNA, clone:LVR010018B07, expressed in liver PREDICTED: Trichechus manatus latirostris apolipoprotein E (APOE), mRNA PREDICTED: Ceratotherium simum simum apolipoprotein E (APOE), mRNA PREDICTED: Ochotona princeps apolipoprotein E (APOE), mRNA PREDICTED: Gorilla gorilla gorilla apolipoprotein E (APOE), mRNA Sus scrofa apolipoprotein E (APOE), mRNA PREDICTED: Orycteropus afer afer apolipoprotein E (APOE), mRNA Human mRNA fragment for apolipoprotein E (apo E) PREDICTED: Ovis aries uncharacterized LOC101112253 (LOC101112253), mRNA

1000

1000

96%

0.0

79%

XM_005957511.1

994

994

90%

0.0

80%

XM_860950.3

994

994

82%

0.0

81%

XM_004767647.1

991

991

91%

0.0

80%

XM_006067540.1

991

991

91%

0.0

80%

XM_006067539.1

991

991

91%

0.0

80%

XM_005957517.1

991

991

91%

0.0

80%

XM_005957516.1

991

991

91%

0.0

80%

XM_005957515.1

991

991

91%

0.0

80%

XM_005957514.1

991

991

91%

0.0

80%

XM_005957513.1

991

991

91%

0.0

80%

XM_005957512.1

989

989

90%

0.0

79%

XM_004401004.1

984

984

91%

0.0

80%

XM_005701775.1

982

982

92%

0.0

79%

AK232315.1

976

976

78%

0.0

82%

XM_004388788.1

973

973

84%

0.0

81%

XM_004440368.1

964 964 955 949 944

964 1436 955 949 944

73% 67% 79% 78% 43%

0.0 0.0 0.0 0.0 0.0

84% 98% 82% 82% 99%

XM_004598038.1 XM_004060985.1 NM_214308.1 XM_007942920.1 X00199.1

933

933

91%

0.0

78%

XM_004015737.1

PREDICTED: Heterocephalus glaber apolipoprotein E (Apoe), transcript variant X2, mRNA PREDICTED: Jaculus jaculus apolipoprotein E (Apoe), mRNA PREDICTED: Condylura cristata apolipoprotein E (APOE), mRNA PREDICTED: Pteropus alecto apolipoprotein E (APOE), mRNA PREDICTED: Eptesicus fuscus apolipoprotein E (APOE), mRNA PREDICTED: Heterocephalus glaber apolipoprotein E (Apoe), mRNA PREDICTED: Heterocephalus glaber apolipoprotein E (Apoe), transcript variant X1, mRNA PREDICTED: Loxodonta africana apolipoprotein E-like (LOC100669636), mRNA PREDICTED: Saimiri boliviensis boliviensis apolipoprotein E (APOE), mRNA PREDICTED: Dasypus novemcinctus apolipoprotein E (APOE), mRNA PREDICTED: Mesocricetus auratus apolipoprotein E (Apoe), mRNA Hylobates lar isolate G001 apolipoprotein E4 gene, partial cds

922

922

84%

0.0

79%

XM_004873142.1

917 908 902 901 901

917 908 902 901 901

74% 78% 83% 78% 81%

0.0 0.0 0.0 0.0 0.0

82% 81% 80% 81% 79%

XM_004670291.1 XM_004694178.1 XM_006911788.1 XM_008158369.1 XM_004910074.1

899

899

79%

0.0

80%

XM_004873141.1

899

899

78%

0.0

81%

XM_003406443.1

884

1425

79%

0.0

92%

XM_003940424.1

883 879 875

883 879 875

82% 83% 41%

0.0 0.0 0.0

79% 79% 98%

XM_004484038.1 XM_005086320.1 FJ948092.1

Alignments
Homo sapiens apolipoprotein E (APOE), mRNA Sequence ID: ref|NM_000041.2| Length: 1223 Number of Matches: 1 Range 1: 1 to 1223
Score Expect Identities Gaps Strand Frame

2206 bits(2446) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct 1 1 61 61 121 121 181 181 241 241 301 301 361 361

0.0()

1223/1223(100%)

0/1223(0%)

Plus/Plus

GGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG ACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCC TGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGC GCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGG ATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCC AGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACA AATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCA

60 60 120 120 180 180 240 240 300 300 360 360 420 420

Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

421 421 481 481 541 541 601 601 661 661 721 721 781 781 841 841 901 901 961 961 1021 1021 1081 1081 1141 1141 1201 1201

AGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCC TGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGG TGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACC TGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCA GCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTG TGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGC GCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGC AGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCG AGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCC AGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGC CCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCC TCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGG GTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCACGCaaaaaaaaaaaaaaaaaaaaa |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCACGCAAAAAAAAAAAAAAAAAAAAA aaaaaaaaaaaaaaaaaaaaaaa ||||||||||||||||||||||| AAAAAAAAAAAAAAAAAAAAAAA 1223 1223

480 480 540 540 600 600 660 660 720 720 780 780 840 840 900 900 960 960 1020 1020 1080 1080 1140 1140 1200 1200

Homo sapiens apolipoprotein E, mRNA (cDNA clone MGC:1571 IMAGE:3355712), complete cds Sequence ID: gb|BC003557.1| Length: 1186 Number of Matches: 1 Range 1: 1 to 1185
Score Expect Identities Gaps Strand Frame

2138 bits(2370) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query 39 1 99 61 159 121 219 181 279

0.0()

1185/1185(100%)

0/1185(0%)

Plus/Plus

GGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGG GCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAG ACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAA CTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTG CAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACC

98 60 158 120 218 180 278 240 338

Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

241 339 301 399 361 459 421 519 481 579 541 639 601 699 661 759 721 819 781 879 841 939 901 999 961 1059 1021 1119 1081 1179 1141

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACC ATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAG GAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGAC ATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGC CAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGG CTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGC GAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAG GGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCC CAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGAC CGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCC CAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCC CTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTG GGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATG CGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCC CCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCACG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCACG Caaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa ||||||||||||||||||||||||||||||||||||||||||||| CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1223 1185

300 398 360 458 420 518 480 578 540 638 600 698 660 758 720 818 780 878 840 938 900 998 960 1058 1020 1118 1080 1178 1140

Homo sapiens cDNA clone IMAGE:6263100, **** WARNING: chimeric clone **** Sequence ID: gb|BC072022.1| Length: 1550 Number of Matches: 1 Range 1: 369 to 1550
Score Expect Identities Gaps Strand Frame

2132 bits(2364) Features: Query Sbjct Query Sbjct Query Sbjct 39 369 99 429 159 489

0.0()

1182/1182(100%)

0/1182(0%)

Plus/Plus

GGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGG GCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAG ACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAA

98 428 158 488 218 548

Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

219 549 279 609 339 669 399 729 459 789 519 849 579 909 639 969 699 1029 759 1089 819 1149 879 1209 939 1269 999 1329 1059 1389 1119 1449 1179 1509

CTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTG CAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACC ATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAG GAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGAC ATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGC CAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGG CTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGC GAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAG GGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCC CAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGAC CGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCC CAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCC CTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTG GGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATG CGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCC CCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCACG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCACG Caaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa |||||||||||||||||||||||||||||||||||||||||| CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1220 1550

278 608 338 668 398 728 458 788 518 848 578 908 638 968 698 1028 758 1088 818 1148 878 1208 938 1268 998 1328 1058 1388 1118 1448 1178 1508

Homo sapiens preapolipoprotein E (APOE) mRNA, complete cds Sequence ID: gb|K00396.1|HUMAPOE3 Length: 1156 Number of Matches: 1 Range 1: 3 to 1156
Score Expect Identities Gaps Strand Frame

2082 bits(2308) Features: Query Sbjct Query 26 3 86

0.0()

1154/1154(100%)

0/1154(0%)

Plus/Plus

CAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAAGAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAAGAT GAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGA

85 62 145

Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

63 146 123 206 183 266 243 326 303 386 363 446 423 506 483 566 543 626 603 686 663 746 723 806 783 866 843 926 903 986 963 1046 1023 1106 1083 1166 1143

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGA GCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGG CCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACT GTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCT GATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGAC CCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCG GCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCA GGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAA GCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCA GGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCC CCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCT ACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAG CCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCT GGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAG CTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGT GCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGAACGCCGAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGAACGCCGAA GCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCG GGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTC ACCAAGTTTCACGC |||||||||||||| ACCAAGTTTCACGC 1179 1156

122 205 182 265 242 325 302 385 362 445 422 505 482 565 542 625 602 685 662 745 722 805 782 865 842 925 902 985 962 1045 1022 1105 1082 1165 1142

Human apolipoprotein E mRNA, complete cds Sequence ID: gb|M12529.1|HUMAPOE Length: 1157 Number of Matches: 1 Range 1: 1 to 1157
Score Expect Identities Gaps Strand Frame

2060 bits(2284) Features:

0.0()

1151/1157(99%)

0/1157(0%)

Plus/Plus

Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

23 1 83 61 143 121 203 181 263 241 323 301 383 361 443 421 503 481 563 541 623 601 683 661 743 721 803 781 863 841 923 901 983 961 1043 1021 1103 1081 1163 1141

CCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAA GATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGT GGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAG CGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGAC ACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGC ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAAGTCACCCAAGAACTGAGGGC GCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACT GACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGC ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| GACCCCGGTAGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGACGGCGCAGGC CCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGT GCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCG CAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTA |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| CAAGCTGCGTAAGCGGCTCCTCCGCGATCCCGATGACCTGCAGAAGCGCCTGGCAGTGTA CCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGG GCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCC GCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGG CAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAA ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGTCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAA GCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAA GAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAA GGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGAACGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGAACGCC GAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCA GCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGA TTCACCAAGTTTCACGC ||||||||||||||||| TTCACCAAGTTTCACGC 1179 1157

82 60 142 120 202 180 262 240 322 300 382 360 442 420 502 480 562 540 622 600 682 660 742 720 802 780 862 840 922 900 982 960 1042 1020 1102 1080 1162 1140

PREDICTED: Pan paniscus apolipoprotein E (APOE), transcript variant X1, mRNA Sequence ID: ref|XM_003817545.2| Length: 1259 Number of Matches: 1 Range 1: 79 to 1255

Score

Expect

Identities

Gaps

Strand

Frame

2046 bits(2268) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct 1 79 61 139 121 199 181 259 241 319 301 379 361 439 421 499 481 559 541 619 601 679 661 739 721 799 781 859 841 919 901 979 961 1039 1021 1099 1081 1159 1141 1219

0.0()

1160/1177(99%)

0/1177(0%)

Plus/Plus

GGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG ACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCC TGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGC |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| TGGCAGGATGCCAGGCCAAGGTGGAGCAAGTGGTGGAGACAGAGCCGGAGCCCGAGCTGC GCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGG ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| ACCAGCAGGCCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCACTTTTGGG ATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCC AGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACA |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| AGGTCACCCAGGAACTGACGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACA AATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCA ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| AATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCCCGGCTGTCCA AGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCC |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| AGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGCGCGGCCGCC TGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGG TGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACC |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| CGCGCCTCGCCTCCCACCTGCGCAAGCTGCGCAAGCGGCTGCTCCGCGATGCCGATGACC TGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| TGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCGTCA GCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTG ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| GCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGTGTGCGGGCCGCCACTG TGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGC ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| TGGGCTCCCTGGCCGGCCAGCCGCTGCAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGC GCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGC AGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCG AGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCC AGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGC ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| AGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCATGGGCACCAGCGCCGCCCCTGTGC CCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCC TCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGG ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| TCCTGCCTCAGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTGCTGGG GTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCAC |||| |||||||||||||||||||||||||||||||| GTGGGCCCTAGTTTAATAAAGATTCACCAAGTTTCAC 1177 1255

60 138 120 198 180 258 240 318 300 378 360 438 420 498 480 558 540 618 600 678 660 738 720 798 780 858 840 918 900 978 960 1038 1020 1098 1080 1158 1140 1218

PREDICTED: Homo sapiens apolipoprotein E (APOE), transcript variant X1, mRNA Sequence ID: ref|XM_005258867.1| Length: 1237 Number of Matches: 1 Range 1: 117 to 1237
Score Expect Identities Gaps Strand Frame

2022 bits(2242) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct 60 117 120 177 180 237 240 297 300 357 360 417 420 477 480 537 540 597 600 657 660 717 720 777 780 837 840 897 900 957 960 1017 1020 1077 1080 1137 1140 1197

0.0()

1121/1121(100%)

0/1121(0%)

Plus/Plus

GACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTC CTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTG CGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGG GATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCC CAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTAC AAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCC AAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGC CTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGG GTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGAC CTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTC AGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACT GTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTG CGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAG CAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCC GAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGC CAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTG CCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGC CTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGG GGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCACGCa ||||||||||||||||||||||||||||||||||||||||| GGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCACGCA 1180 1237

119 176 179 236 239 296 299 356 359 416 419 476 479 536 539 596 599 656 659 716 719 776 779 836 839 896 899 956 959 1016 1019 1076 1079 1136 1139 1196

PREDICTED: Pan paniscus apolipoprotein E (APOE), transcript variant X2, mRNA Sequence ID: ref|XM_008970765.1| Length: 1246 Number of Matches: 2 Range 1: 125 to 1242
Score Expect Identities Gaps Strand Frame

1939 bits(2150) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query 60 125 120 185 180 245 240 305 300 365 360 425 420 485 480 545 540 605 600 665 660 725 720 785 780 845 840 905 900 965 960 1025 1020 1085 1080 1145 1140

0.0()

1101/1118(98%)

0/1118(0%)

Plus/Plus

GACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTC CTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTG ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| CTGGCAGGATGCCAGGCCAAGGTGGAGCAAGTGGTGGAGACAGAGCCGGAGCCCGAGCTG CGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGG | ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| CACCAGCAGGCCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCACTTTTGG GATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCC CAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTAC ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| CAGGTCACCCAGGAACTGACGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTAC AAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCC |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| AAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCCCGGCTGTCC AAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGC ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| AAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGCGCGGCCGC CTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGG GTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGAC | |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| GCGCGCCTCGCCTCCCACCTGCGCAAGCTGCGCAAGCGGCTGCTCCGCGATGCCGATGAC CTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTC ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || CTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCGTC AGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACT |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| AGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGTGTGCGGGCCGCCACT GTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTG |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| GTGGGCTCCCTGGCCGGCCAGCCGCTGCAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTG CGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAG CAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCC GAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGC CAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTG |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| CAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCATGGGCACCAGCGCCGCCCCTGTG CCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGC CTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGG |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| CTCCTGCCTCAGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTGCTGG GGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCAC ||||| |||||||||||||||||||||||||||||||| 1177

119 184 179 244 239 304 299 364 359 424 419 484 479 544 539 604 599 664 659 724 719 784 779 844 839 904 899 964 959 1024 1019 1084 1079 1144 1139 1204

Sbjct

1205

GGTGGGCCCTAGTTTAATAAAGATTCACCAAGTTTCAC

1242

Range 2: 1 to 39
Score Expect Identities Gaps Strand Frame

71.6 bits(78) Features: Query Sbjct 22 1

2e-08()

39/39(100%)

0/39(0%)

Plus/Plus

GCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG ||||||||||||||||||||||||||||||||||||||| GCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG

60 39

PREDICTED: Papio anubis apolipoprotein E (APOE), mRNA Sequence ID: ref|XM_003918599.2| Length: 1259 Number of Matches: 1 Range 1: 79 to 1255
Score Expect Identities Gaps Strand Frame

1902 bits(2108) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query 1 79 61 139 121 199 181 259 241 319 301 379 361 439 421 499 481 559 541 619 601 679 661 739 721 799 781 859 841

0.0()

1128/1177(96%)

0/1177(0%)

Plus/Plus

GGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG ACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCC TGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGC ||||||||||||||||||||||||||||| |||||||| ||||| | || |||||||| | TGGCAGGATGCCAGGCCAAGGTGGAGCAACCGGTGGAGCCAGAGACAGAACCCGAGCTTC GCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGG |||||||| | ||||||||||||||||||| |||||| |||||||||||||||||||||| GCCAGCAGGCTGAGTGGCAGAGCGGCCAGCCCTGGGAGCTGGCACTGGGTCGCTTTTGGG ATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCCCCC AGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACA |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| AGGTCACCCAGGAACTGACGACGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACA AATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCA ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| AATCGGAACTGGAGGAACAGCTGAGCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCA AGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCC ||||||||||||||||||||||||||||||| || ||||||||||||||| || |||||| AGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGTGCCGACATGGAGGACGTGCGCAGCCGCC TGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGG |||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||| TGGTGCAGTACCGCAGCGAGGTGCAGGCCATGCTGGGCCAGAGTACCGAGGAGCTGCGGG TGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACC |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| CGCGCCTCGCCTCCCACCTGCGCAAGCTGCGCAAGCGGCTCCTCCGCGATGCTGATGACC TGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCA |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| TGCAGAAGCGCCTGGCAGTGTATCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGGGTCA GCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTG |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| GCGCCATCCGCGAGCGCCTGGGACCCCTGGTGGAGCAGGGCCGCGTGCGGGCCGCCACTG TGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGC |||||||||||||| |||||||||| ||||||||||||||||||| ||| |||||||||| TGGGCTCCCTGGCCAGCCAGCCGCTTCAGGAGCGGGCCCAGGCCTTGGGTGAGCGGCTGC GCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGC |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCGCACGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGC AGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCG

60 138 120 198 180 258 240 318 300 378 360 438 420 498 480 558 540 618 600 678 660 738 720 798 780 858 840 918 900

Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

919 901 979 961 1039 1021 1099 1081 1159 1141 1219

||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| AGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAACAGGCCCAGCAGATAAGCCTGCAGGCCG AGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCC AGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGC ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| AGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCGCCAGCACCGCCCCTGTGC CCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCC |||||||||||||||||||||| | ||| |||||||||||||| || |||||||||||| CCAGCGACAATCACTGAACGCCCAGACCTACAGCCATGCGACCCGACTCCACCCCGTGCC TCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGG ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| TCCTGCCACCGCTCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGG GTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCAC |||| |||||||||||||||||||| ||||||||||| GTGGGCCCTAGTTTAATAAAGATTCGCCAAGTTTCAC 1177 1255

978 960 1038 1020 1098 1080 1158 1140 1218

Macaca fascicularis mRNA, complete cds, clone Qlv-U403A-F8: similar to Homo sapiens apolipoprotein E (APOE), mRNA, NM_000041.2 Sequence ID: dbj|AK240626.1| Length: 1184 Number of Matches: 1 Range 1: 1 to 1184
Score Expect Identities Gaps Strand Frame

1884 bits(2088) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct 15 1 75 61 135 121 195 181 255 241 315 301 375 361 435 421 495 481 555 541 615 601 675 661 735 721

0.0()

1129/1184(95%)

1/1184(0%)

Plus/Plus

CTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACA GGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAG GCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAG ||||||||||||||| |||||||| ||||| |||| |||||||| ||||||||| | ||| GCCAAGGTGGAGCAACCGGTGGAGCCAGAGACGGAACCCGAGCTTCGCCAGCAGGCTGAG TGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGG ||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| GGGCAGAGCGGCCAGCCCTGGGAGCTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGG GTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAA |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| GTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCCCCCAGGTCACCCAGGAA CTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAG |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGACGACGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAG GAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCG ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| GAACAGCTGAGCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCG GCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGC ||||||||||||||||| || ||||||||||||||| || |||||||||||||||||||| GCGCAGGCCCGGCTGGGTGCCGACATGGAGGACGTGCGCAGCCGCCTGGTGCAGTACCGC GGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCC ||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||| AGCGAGGTGCAGGCCATGCTGGGCCAGAGTACCGAGGAGCTGCGGGCGCGCCTCGCCTCC CACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTG ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| CACCTGCGCAAGCTGCGCAAGCGGCTCCTCCGCGATGCTGATGACCTGCAGAAGCGCCTG GCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAG |||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| GCAGTGTATCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGGGTCAGCGCCATCCGCGAG CGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCC |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| CGCCTGGGACCCCTGGTGGAGCAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCC GGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAG |||||||||| ||||||||||||||||||| ||| |||||||| ||||| ||||||||| AGCCAGCCGCTTCAGGAGCGGGCCCAGGCCTTGGGTGAGCGGCTTCGCGCACGGATGGAG

74 60 134 120 194 180 254 240 314 300 374 360 434 420 494 480 554 540 614 600 674 660 734 720 794 780

Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

795 781 855 841 915 901 975 961 1035 1021 1095 1081 1155 1141

GAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTG CGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCC ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| CGCGCCAAGCTGGAGGAACAGGCCCAGCAGATAAGCCTGCAGGCCGAGGCCTTCCAGGCC CGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTG ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| CGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGATATGCAGCGCCAGTGGGCTGGGCTG GTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCAC ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| GTGGAGAAGGTGCAGGCTGCCGTGGGCGCCAGCACCGCCCCTGTGCCCAGCGACAATCAC TGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGC |||||||| | |||| |||||||||||||| || ||||||| |||||||| |||||| | TGAACGCCCAGGCCTACAGCCATGCGACCCGACTCCACCCCATGCCTCCTCTCTCCGCTC AGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTT |||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| AGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCAGGGGTGGGCCCTAGTTT AATAAAGATTCACCAAGTTTCA-CGCaaaaaaaaaaaaaaaaaa ||||||||||| |||||||||| ||||||||||||||||||||| AATAAAGATTCGCCAAGTTTCACCGCAAAAAAAAAAAAAAAAAA 1197 1184

854 840 914 900 974 960 1034 1020 1094 1080 1154 1140

PREDICTED: Macaca fascicularis apolipoprotein E (APOE), transcript variant X1, mRNA Sequence ID: ref|XM_005589553.1| Length: 1383 Number of Matches: 1 Range 1: 203 to 1379
Score Expect Identities Gaps Strand Frame

1871 bits(2074) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query 1 203 61 263 121 323 181 383 241 443 301 503 361 563 421 623 481 683 541 743 601 803 661

0.0()

1121/1177(95%)

0/1177(0%)

Plus/Plus

GGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG ACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCC TGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGC ||||||||||||||||||||||||||||| |||||||| ||||| |||| |||||||| | TGGCAGGATGCCAGGCCAAGGTGGAGCAACCGGTGGAGCCAGAGACGGAACCCGAGCTTC GCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGG |||||||| | ||| ||||||||||||||| |||||| |||||||||||||||||||||| GCCAGCAGGCTGAGGGGCAGAGCGGCCAGCCCTGGGAGCTGGCACTGGGTCGCTTTTGGG ATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCCCCC AGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACA |||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||| AGGTCACCCAGGAACTGACGACGCTGATGGATGAGACCATGAAGGAGTTGAAGGCCTACA AATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCA ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| AATCGGAACTGGAGGAACAGCTGAGCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCA AGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCC ||||||||||||||||||||||||||||||| || ||||||||||||||| || |||||| AGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGTGCCGACATGGAGGACGTGCGCAGCCGCC TGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGG |||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||| TGGTGCAGTACCGCAGCGAGGTGCAGGCCATGCTGGGCCAGAGTACCGAGGAGCTGCGGG TGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACC |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| CGCGCCTCGCCTCCCACCTGCGCAAGCTGCGCAAGCGGCTCCTCCGCGATGCTGATGACC TGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCA |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| TGCAGAAGCGCCTGGCAGTGTATCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGGGTCA GCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTG

60 262 120 322 180 382 240 442 300 502 360 562 420 622 480 682 540 742 600 802 660 862 720

Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

863 721 923 781 983 841 1043 901 1103 961 1163 1021 1223 1081 1283 1141 1343

|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| GCGCCATCCGCGAGCGCCTGGGACCCCTGGTGGAGCAGGGCCGCGTGCGGGCCGCCACTG TGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGC |||||||||||||| |||||||||| ||||||||||||||||||| ||| |||||||| | TGGGCTCCCTGGCCAGCCAGCCGCTTCAGGAGCGGGCCCAGGCCTTGGGTGAGCGGCTTC GCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGC |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCGCACGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGC AGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCG ||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| AGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAACAGGCCCAGCAGATAAGCCTGCAGGCCG AGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCC |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| AGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTCGTGGAAGATATGCAGCGCC AGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGC ||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||| AGTGGGCTGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCGCCAGCACCGCCCCTGTGC CCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCC |||||||||||||||||||||| | |||| |||||||||||||| || ||||||| |||| CCAGCGACAATCACTGAACGCCCAGGCCTACAGCCATGCGACCCGACTCCACCCCATGCC TCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGG |||| |||||| ||||||||||||||||||||||||||||||||||||||||||| ||| TCCTCTCTCCGCTCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCAGGG GTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCAC |||| |||||||||||||||||||| ||||||||||| GTGGGCCCTAGTTTAATAAAGATTCGCCAAGTTTCAC 1177 1379

922 780 982 840 1042 900 1102 960 1162 1020 1222 1080 1282 1140 1342

PREDICTED: Chlorocebus sabaeus apolipoprotein E (APOE), transcript variant X1, mRNA Sequence ID: ref|XM_007997155.1| Length: 1234 Number of Matches: 1 Range 1: 43 to 1230
Score Expect Identities Gaps Strand Frame

1864 bits(2066) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct 1 43 61 103 121 163 181 223 241 283 301 343 361 403 421 463 481 523 541 583

0.0()

1125/1188(95%)

11/1188(0%)

Plus/Plus

GGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGATCCTTGAGTCCTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCG ACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCC ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ACTGGCCAATCACAGGCAGGACGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCC TGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGC ||||||||||||||||||||||||||||| |||||||| ||||| |||| |||||||||| TGGCAGGATGCCAGGCCAAGGTGGAGCAACCGGTGGAGCCAGAGACGGAACCCGAGCTGC GCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGG ||| |||||| ||||||||||||||||||| |||||| |||||||||||||||||||||| GCCCGCAGACTGAGTGGCAGAGCGGCCAGCCCTGGGAGCTGGCACTGGGTCGCTTTTGGG ATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCCCCC AGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACA |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| AGGTCACCCAGGAACTGACGACGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACA AATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCA ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| AATCGGAACTGGAGGAACAGCTGAGCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCA AGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCC ||||||||||||||||||||||||||||||| || ||||||||||||||| || |||||| AGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGTGCCGACATGGAGGACGTGCGCAGCCGCC TGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGG |||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||| TGGTGCAGTACCGCAGCGAGGTGCAGGCCATGCTGGGCCAGAGTACCGAGGAGCTGCGGG TGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACC |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| CGCGCCTCGCCTCCCACCTGCGCAAGCTGCGCAAGCGGCTCCTCCGCGATGCTGATGACC

60 102 120 162 180 222 240 282 300 342 360 402 420 462 480 522 540 582 600 642

Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

601 643 661 703 721 763 781 823 841 883 901 943 961 1003 1021 1063 1070 1123 1130 1183

TGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCA |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| TGCAGAAGCGCCTGGCAGTGTATCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGGGTCA GCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTG | |||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||| GTGCCATCCGTGAGCGCCTGGGACCCCTGGTGGAGCAGGGCCGCGTGCGGGCCGCCACTG TGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGC |||||||||||||| |||||||||| ||||||||||||||||||| ||| |||||||||| TGGGCTCCCTGGCCAGCCAGCCGCTTCAGGAGCGGGCCCAGGCCTTGGGTGAGCGGCTGC GCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGC |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCGCACGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGC AGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCG ||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| AGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAACAGGCCCAGCAGATAAGCCTGCAGGCCG AGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCC ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| AGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGATATGCAGCGCC AGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGC ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| AGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCGCCAGCACCGCCCCTGTGC CCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATG-----------CGACCCCACGC |||||||||||||||||||||| | |||| |||||||| |||||| || | CCAGCGACAATCACTGAACGCCCAGGCCTACAGCCATGCTACCCGACTCCGACCCGACTC CACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCC |||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||| CACCCCATGCCTCCTGCCTCCGCTCAGCCTGCAGCGGGAGACCCTGTCCCTGCCCCAGCC GTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCAC |||||||||||||| |||||||||||||||||||| ||||||||||| CTCCTCCTGGGGTGGGCCCTAGTTTAATAAAGATTCGCCAAGTTTCAC 1177 1230

660 702 720 762 780 822 840 882 900 942 960 1002 1020 1062 1069 1122 1129 1182

Homo sapiens cDNA, FLJ95802, Homo sapiens apolipoprotein E (APOE), mRNA Sequence ID: dbj|AK314898.1| Length: 1023 Number of Matches: 1 Range 1: 1 to 1023
Score Expect Identities Gaps Strand Frame

1840 bits(2040) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query 15 1 75 61 135 121 195 181 255 241 315 301 375 361 435 421 495

0.0()

1022/1023(99%)

0/1023(0%)

Plus/Plus

CTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACA GGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAG |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| GGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCGGGATGCCAG GCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAG TGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGG GTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAA CTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAG GAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCG GCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGC GGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCC

74 60 134 120 194 180 254 240 314 300 374 360 434 420 494 480 554

Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

481 555 541 615 601 675 661 735 721 795 781 855 841 915 901 975 961 1035 1021

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCC CACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTG GCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAG CGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCC GGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAG GAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTG CGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCC CGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTG GTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCAC TGA ||| TGA 1037 1023

540 614 600 674 660 734 720 794 780 854 840 914 900 974 960 1034 1020

Monkey mRNA for apolipoprotein E Sequence ID: emb|X13887.1| Length: 1178 Number of Matches: 1 Range 1: 1 to 1176
Score Expect Identities Gaps Strand Frame

1817 bits(2014) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct 15 1 65 61 122 121 182 181 242 241 302 301 362 361 422 421 482 481

0.0()

1107/1176(94%)

13/1176(1%)

Plus/Plus

CTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTG---------|||||||||||||||||||||||||||||||||||||||||||||||||| CTACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGCCAAGGCGAG ---GCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCT ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTTGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCT GGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCG |||||||||||||||||||||||||||| |||||||| ||||| |||| |||||||| || GGCAGGATGCCAGGCCAAGGTGGAGCAACCGGTGGAGCCAGAGACGGAACCCGAGCTTCG CCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGA ||||||| | ||| | ||||||||||||| |||||| ||||||||||||||||||||||| CCAGCAGGCTGAGGGCCAGAGCGGCCAGCCCTGGGAGCTGGCACTGGGTCGCTTTTGGGA TTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCA ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| TTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCCCCCA GGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAA ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| GGTCACCCAGGAACTGACGACGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAA ATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAA |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ATCGGAACTGGAGGAACAGCTGAGCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAA GGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCT |||||||||||||||||||||||||||||| || ||||||||||||||| || ||||||| GGAGCTGCAGGCGGCGCAGGCCCGGCTGGGTGCCGACATGGAGGACGTGCGCAGCCGCCT GGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGT ||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||| GGTGCAGTACCGCAGCGAGGTGCAGGCCATGCTGGGCCAGAGTACCGAGGAGCTGCGGGC

64 60 121 120 181 180 241 240 301 300 361 360 421 420 481 480 541 540

Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

542 541 602 601 662 661 722 721 782 781 842 841 902 901 962 961 1022 1021 1082 1081 1142 1141

GCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCT |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| GCGCCTCGCCTCCCACCTGCGCAAGCTGCGCAAGCGGCTCCTCCGCGATGCTGATGACCT GCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAG ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| GCAGAAGCGCCTGGCAGTGTATCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGGGTCAG CGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGT ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| CGCCATCCGCGAGCGCCTGGGACCCCTGGTGGAGCAGGGCCGCGTGCGGGCCGCCACTGT GGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCG ||||||||||||| |||||||||| ||||||||||||||||||| ||| |||||||| || GGGCTCCCTGGCCAGCCAGCCGCTTCAGGAGCGGGCCCAGGCCTTGGGTGAGCGGCTTCG CGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCA ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCACGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCA GGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGA |||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| GGTGGCGGAGGTGCGCGCCAAGCTGGAGGAACAGGCCCAGCAGATAAGCCTGCAGGCCGA GGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCA |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| GGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGATATGCAGCGCCA GTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCC |||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||| GTGGGCTGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCGCCAGCACCGCCCCTGTGCC CAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCT || |||||||||||||||||| | |||| |||||||||||||| || ||||||| ||||| CATCGACAATCACTGAACGCCCAGGCCTACAGCCATGCGACCCGACTCCACCCCATGCCT CCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGG ||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |||| CCTCTCTCCGCTCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCAGGGG TGGACCCTAGTTTAATAAAGATTCACCAAGTTTCAC ||| |||||||||||||||||||| ||||||||||| TGGGCCCTAGTTTAATAAAGATTCGCCAAGTTTCAC 1177 1176

601 600 661 660 721 720 781 780 841 840 901 900 961 960 1021 1020 1081 1080 1141 1140

PREDICTED: Pongo abelii apolipoprotein E (APOE), partial mRNA Sequence ID: ref|XM_002829380.3| Length: 1065 Number of Matches: 1 Range 1: 13 to 1064
Score Expect Identities Gaps Strand Frame

1784 bits(1978) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query 126 13 186 73 246 133 306 193 366 253 426 313 486 373 546

0.0()

1027/1052(98%)

0/1052(0%)

Plus/Plus

GGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAG |||||||||||||| |||||||||| ||||||| |||| | ||||||||||||||||||| GGATGCCAGGCCAACGTGGAGCAAGTGGTGGAGCCAGACCTGGAGCCCGAGCTGCGCCAG CAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTAC ||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| CAGGCCGAGTGGCAGAGCGGCCAGCGCTGGGAGCTGGCGCTGGGTCGCTTTTGGGATTAC CTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTC || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| CTTCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAACTCCCAGGTC ACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCG ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ACCCAGGAACTGACGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCG GAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAG CTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTG ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| CTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGCGCGGCCGCCTGGTG CAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGC ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| CAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGCGCGC CTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAG

185 72 245 132 305 192 365 252 425 312 485 372 545 432 605

Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

433 606 493 666 553 726 613 786 673 846 733 906 793 966 853 1026 913 1086 973 1146 1033

|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| CTCGCCTCCCACCTGCGCAAGCTGCGCAAGCGGCTCCTCCGCGATGCCGATGACCTGCAG AAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCC ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| AAGCGTCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCGTCAGCGCC ATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGC TCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCG ||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| TCCGTGGCCGGCAAGCCGCTGCAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCG CGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTG GCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCC TTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGG GCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGC GACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCTCCTG ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| GACAATCACTGAACGCCCAAGCCTGCAGCCATGCGACCCCACTCCACCCCGTGCCTCCTG CCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGGTGGA ||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||| CCTCCGCTCAGCCTGCAGCGGGAGACCCTGTCCCTGCCCCAGCCGTCCCCCTGGGGTGGG CCCTAGTTTAATAAAGATTCACCAAGTTTCAC |||||||||||||||||||||||||||||||| CCCTAGTTTAATAAAGATTCACCAAGTTTCAC 1177 1064

492 665 552 725 612 785 672 845 732 905 792 965 852 1025 912 1085 972 1145 1032

PREDICTED: Macaca fascicularis apolipoprotein E (APOE), transcript variant X2, mRNA Sequence ID: ref|XM_005589554.1| Length: 1183 Number of Matches: 1 Range 1: 62 to 1179
Score Expect Identities Gaps Strand Frame

1764 bits(1956) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct 60 62 120 122 180 182 240 242 300 302 360 362 420 422 480 482

0.0()

1062/1118(95%)

0/1118(0%)

Plus/Plus

GACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTC CTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTG |||||||||||||||||||||||||||||| |||||||| ||||| |||| |||||||| CTGGCAGGATGCCAGGCCAAGGTGGAGCAACCGGTGGAGCCAGAGACGGAACCCGAGCTT CGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGG ||||||||| | ||| ||||||||||||||| |||||| ||||||||||||||||||||| CGCCAGCAGGCTGAGGGGCAGAGCGGCCAGCCCTGGGAGCTGGCACTGGGTCGCTTTTGG GATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCC ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || GATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCCCC CAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTAC ||||||||||||||||||| | |||||||||| ||||||||||||||||||||||||||| CAGGTCACCCAGGAACTGACGACGCTGATGGATGAGACCATGAAGGAGTTGAAGGCCTAC AAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCC |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| AAATCGGAACTGGAGGAACAGCTGAGCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCC AAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGC |||||||||||||||||||||||||||||||| || ||||||||||||||| || ||||| AAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGTGCCGACATGGAGGACGTGCGCAGCCGC CTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGG ||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||| CTGGTGCAGTACCGCAGCGAGGTGCAGGCCATGCTGGGCCAGAGTACCGAGGAGCTGCGG

119 121 179 181 239 241 299 301 359 361 419 421 479 481 539 541

Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

540 542 600 602 660 662 720 722 780 782 840 842 900 902 960 962 1020 1022 1080 1082 1140 1142

GTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGAC | |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| GCGCGCCTCGCCTCCCACCTGCGCAAGCTGCGCAAGCGGCTCCTCCGCGATGCTGATGAC CTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTC ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || CTGCAGAAGCGCCTGGCAGTGTATCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGGGTC AGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACT ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| AGCGCCATCCGCGAGCGCCTGGGACCCCTGGTGGAGCAGGGCCGCGTGCGGGCCGCCACT GTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTG ||||||||||||||| |||||||||| ||||||||||||||||||| ||| |||||||| GTGGGCTCCCTGGCCAGCCAGCCGCTTCAGGAGCGGGCCCAGGCCTTGGGTGAGCGGCTT CGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAG ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCGCACGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAG CAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCC |||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| CAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAACAGGCCCAGCAGATAAGCCTGCAGGCC GAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGC ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| GAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTCGTGGAAGATATGCAGCGC CAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTG |||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||| CAGTGGGCTGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCGCCAGCACCGCCCCTGTG CCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGC ||||||||||||||||||||||| | |||| |||||||||||||| || ||||||| ||| CCCAGCGACAATCACTGAACGCCCAGGCCTACAGCCATGCGACCCGACTCCACCCCATGC CTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGG ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| || CTCCTCTCTCCGCTCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCAGG GGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCAC ||||| |||||||||||||||||||| ||||||||||| GGTGGGCCCTAGTTTAATAAAGATTCGCCAAGTTTCAC 1177 1179

599 601 659 661 719 721 779 781 839 841 899 901 959 961 1019 1021 1079 1081 1139 1141

PREDICTED: Nomascus leucogenys apolipoprotein E (APOE), mRNA Sequence ID: ref|XM_004091027.1| Length: 1120 Number of Matches: 1 Range 1: 1 to 1114
Score Expect Identities Gaps Strand Frame

1759 bits(1950) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query 84 1 128 61 183 121 243 181 303 241 363 301 423 361 482

0.0()

1059/1116(95%)

24/1116(2%)

Plus/Plus

ATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGG---------------|||||||||||||||||||||||||||||||||||||||||||| ATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGTATGGGGGCGGGGCTT -----ATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGC |||||||||||||||||| |||||||||||| |||||||||| |||||||||||| GCTCGATGCCAGGCCAAGGTGGAACAAGCGGTGGAGCCAGAGCCGGAACCCGAGCTGCGC CAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGAT |||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||| CAGCAGGCCGAGTGGCAGAGCGGCCAGCGCTGGGAGCTGGCGCTGGGTCGCTTTTGGGAT TACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAG |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| TACCTGCGCTGGGTGCAGGCACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAG GTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAA || ||||||||||||| |||| ||||||| |||||||||||||||||||||||||||| | GTTACCCAGGAACTGACGGCGTTGATGGATGAGACCATGAAGGAGTTGAAGGCCTACAGA TCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAG ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| TCGGAACTGGAGGAACAACTGACGCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAG GAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGA-GGACGTGTGCGGCCGCCT |||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||||| GAGCTGCAGGCGGCGCAG-CCCGGCTGGGCGCGGACATGGAAGGACGTGCGCGGCCGCCT GGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGT

127 60 182 120 242 180 302 240 362 300 422 360 481 419 541

Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

420 542 480 602 540 662 600 722 660 782 720 842 780 902 840 962 900 1022 960 1082 1020 1142 1079

|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| GGTGCAGTACCGCGGCGAGGTGCATGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGC GCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCT |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| GCGCCTTGCCTCCCACCTGCGCAAGCTGCGCAAGCGGCTCCTCCGCGATGCCGATGACCT GCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAG ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| GCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCGTCAG CGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGT ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| CGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAGCAGGGCCGCGTGCGGGCCGCCACTGT GGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCG |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| GGGCTCCCTGGCCGGCCAGCCGCTGCAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCG CGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCA |||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||| CGCGCGGATGGAGGAGGTGGGCGGTCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCA GGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGA GGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCA GTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCC ||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| GTGGGCCGGGCTGGTGGAGAAGGTGCAGGTTGCTGTGGGCACCAGCGCCGCCCCTGTGCC CAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATGCGACCCCACGCCACCCCGTGCCT ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| | CAGCGACAATCACTGAACGCCCAAGCCTGCAGCCATGCGACCCCACTCCACCCCGTGCTT CCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGCCGTCCTCCTGGGG ||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||| CCTGCCTCCGCTCAGCCTGCAGC-GGAGACCCTGTCCCCGCCGCAGCCGTCCTCCTGGGG TGGACCCTAGTTTAATAAAGATTCACCAAGTTTCAC ||| ||||||||||||||| |||||||||||||||| TGGGCCCTAGTTTAATAAATATTCACCAAGTTTCAC 1177 1114

479 601 539 661 599 721 659 781 719 841 779 901 839 961 899 1021 959 1081 1019 1141 1078

PREDICTED: Chlorocebus sabaeus apolipoprotein E (APOE), transcript variant X2, mRNA Sequence ID: ref|XM_007997156.1| Length: 1196 Number of Matches: 1 Range 1: 64 to 1192
Score Expect Identities Gaps Strand Frame

1757 bits(1948) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct 60 64 120 124 180 184 240 244 300 304 360 364 420 424

0.0()

1066/1129(94%)

11/1129(0%)

Plus/Plus

GACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTC |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| GACTGGCCAATCACAGGCAGGACGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTC CTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTG |||||||||||||||||||||||||||||| |||||||| ||||| |||| ||||||||| CTGGCAGGATGCCAGGCCAAGGTGGAGCAACCGGTGGAGCCAGAGACGGAACCCGAGCTG CGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGG |||| |||||| ||||||||||||||||||| |||||| ||||||||||||||||||||| CGCCCGCAGACTGAGTGGCAGAGCGGCCAGCCCTGGGAGCTGGCACTGGGTCGCTTTTGG GATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCC ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || GATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCCCC CAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTAC ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| CAGGTCACCCAGGAACTGACGACGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTAC AAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCC |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| AAATCGGAACTGGAGGAACAGCTGAGCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCC AAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGC |||||||||||||||||||||||||||||||| || ||||||||||||||| || ||||| AAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGTGCCGACATGGAGGACGTGCGCAGCCGC

119 123 179 183 239 243 299 303 359 363 419 423 479 483

Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

480 484 540 544 600 604 660 664 720 724 780 784 840 844 900 904 960 964 1020 1024 1069 1084 1129 1144

CTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGG ||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||| CTGGTGCAGTACCGCAGCGAGGTGCAGGCCATGCTGGGCCAGAGTACCGAGGAGCTGCGG GTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGAC | |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| GCGCGCCTCGCCTCCCACCTGCGCAAGCTGCGCAAGCGGCTCCTCCGCGATGCTGATGAC CTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTC ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || CTGCAGAAGCGCCTGGCAGTGTATCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGGGTC AGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACT || |||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||| AGTGCCATCCGTGAGCGCCTGGGACCCCTGGTGGAGCAGGGCCGCGTGCGGGCCGCCACT GTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTG ||||||||||||||| |||||||||| ||||||||||||||||||| ||| ||||||||| GTGGGCTCCCTGGCCAGCCAGCCGCTTCAGGAGCGGGCCCAGGCCTTGGGTGAGCGGCTG CGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAG ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCGCACGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAG CAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCC |||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| CAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAACAGGCCCAGCAGATAAGCCTGCAGGCC GAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGC |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| GAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGATATGCAGCGC CAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTG |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| CAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCGCCAGCACCGCCCCTGTG CCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATG-----------CGACCCCACG ||||||||||||||||||||||| | |||| |||||||| |||||| || CCCAGCGACAATCACTGAACGCCCAGGCCTACAGCCATGCTACCCGACTCCGACCCGACT CCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCCCCGCCCCAGC ||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||| CCACCCCATGCCTCCTGCCTCCGCTCAGCCTGCAGCGGGAGACCCTGTCCCTGCCCCAGC CGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCAC | |||||||||||||| |||||||||||||||||||| ||||||||||| CCTCCTCCTGGGGTGGGCCCTAGTTTAATAAAGATTCGCCAAGTTTCAC 1177 1192

539 543 599 603 659 663 719 723 779 783 839 843 899 903 959 963 1019 1023 1068 1083 1128 1143

Pan troglodytes apolipoprotein E (APOE), mRNA Sequence ID: ref|NM_001009007.1| Length: 1012 Number of Matches: 1 Range 1: 1 to 1012
Score Expect Identities Gaps Strand Frame

1757 bits(1948) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct 26 1 86 61 146 121 206 181 266 241 326 301

0.0()

997/1012(99%)

0/1012(0%)

Plus/Plus

CAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAAGAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAAGAT GAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGA GCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGG ||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||||| GCAAGTGGTGGAGACAGAGCCGGAGCCCGAGCTGCACCAGCAGGCCGAGTGGCAGAGCGG CCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACT |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| CCAGCGCTGGGAACTGGCGCTGGGTCACTTTTGGGATTACCTGCGCTGGGTGCAGACACT GTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCT ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| GTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGACGGCGCT GATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGAC

85 60 145 120 205 180 265 240 325 300 385 360

Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

386 361 446 421 506 481 566 541 626 601 686 661 746 721 806 781 866 841 926 901 986 961

CCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCG |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| CCCGGTGGCGGAGGAGACGCGGGCCCGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCG GCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCA ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| GCTGGGCGCGGACATGGAGGACGTGCGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCA GGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAA ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| GGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGCGCGCCTCGCCTCCCACCTGCGCAA GCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCA |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| GCTGCGCAAGCGGCTGCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCA GGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCC ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| GGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCGTCAGCGCCATCCGCGAGCGCCTGGGGCC CCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCT ACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAG |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| GCAGGAGAGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAG CCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCT GGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAG CTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGT GCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGA |||||||||| ||||||||||||||||||||||||||||||||||||||||| GCAGGCTGCCATGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGA 1037 1012

445 420 505 480 565 540 625 600 685 660 745 720 805 780 865 840 925 900 985 960

Synthetic construct Homo sapiens clone ccsbBroadEn_14543 APOE gene, encodes complete protein Sequence ID: gb|KJ905144.1| Length: 1083 Number of Matches: 1 Range 1: 66 to 1018
Score Expect Identities Gaps Strand Frame

1719 bits(1906) Features: Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query 84 66 144 126 204 186 264 246 324 306 384 366 444 426 504

0.0()

953/953(100%)

0/953(0%)

Plus/Plus

ATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTG GAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGC GGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACA CTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCG CTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTG ACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCC CGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTG CAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGC ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

143 125 203 185 263 245 323 305 383 365 443 425 503 485 563

Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

486 564 546 624 606 684 666 744 726 804 786 864 846 924 906 984 966

CAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGC AAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTAC CAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGG CCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCG CTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGC AGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAG CTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAG AGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAG GTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTG ||||||||||||||||||||||||||||||||||||||||||||||||||||| GTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTG 1036 1018

545 623 605 683 665 743 725 803 785 863 845 923 905 983 965…...

Similar Documents

Antieke & Zeldzame Boeken | Dinosaur | Up and Away